c - Cut out section of a string with another string -
i got part of c program:
#include <stdio.h> #include <string.h> #include <stdlib.h> int main(void){ char *mrna = spleissen("auaguaaaagcucuguuuaggaga", "gu", "ag"); printf("mrna: %s\n", mrna); free(mrna); return 0; } i have write function spleissen should work this: cuts out string goes gu ag , in between two. program output is:
mrna: auacucugaga i don't know how can cut parts out.
i not allowed use includes other stdio, string , stdlib.
char *spleissen(const char *src, const char *start, const char *end){ size_t len = strlen(src); char *s, *e, *ret, *work; ret = work = malloc(len + 1); strcpy(work, src); len = strlen(end); while(s = strstr(work, start)){ if((e = strstr(s, end))==null) break;//delete upto last? memmove(s, e + len, strlen(e+len)+1); work = s; } return ret; }
Comments
Post a Comment