Overvie

i have javascript html page has action post python file. python code supposed send json html. not know how catch json , parse it. think can parse fine if catch it, , life of me can't work. below html code excerpt python code excerpt. json supposed simple 1 value in it! html code excerpts: <form action="http://www.myurlhiddenhere.com/cgi-bin/new.py" id="form" method="post" enctype="multipart/form-data" target="resiframe"> <div style=" width: 0px; height: 0px; overflow: hidden;" > <input type="hidden" name="random" id="random" value=""> <iframe src="" name="resiframe" id="resiframe" onload="iframeloaded();" ></iframe> </div> and here's try catch it: function iframeloaded() { var result = $.parsejson($("#resiframe").contents().find("html").html()) ....

im in processes of developing rest api using jax-rs , have come across , issue sub resources. able access resource directly sub-resource. example /products return me list of products. /user/1/products return products associated user id 1 only. below way have found it. else have neater/better ways of doing it? thanks reading. ben. @path("/users") public class userresource { @get public list<user> getusers() { /* return users */ } @get @path("{id}") public user getuser(@pathparam("id") int id) { /* return single user */ } @path("{id}/products/") public productresource getproductresource(@pathparam("id") int id) { return new productresource(id); } } @path("/products") public class productresource { private int id; public productresource() { } public productresource(int id) { this.id = id; } @get public lis

i not have code here, going take too space. error in javascript won't run in it, aswell jquery. click here if wanna live... your problem here think: .replace('function mname1()'),('?method??-custom?','function') that comma needs period , i'm guessing replace needs called. .replace('function mname1()').replace('?method??-custom?','function')

i have program when try run in hebrew - characters display lines , boxes - downloaded hebrew font , put font folder in windows , tried use name of font when opening file eg. lang he_il.font-name pgm name - keeps showing me boxes not fluent in techy-terms detailed guidance appreciated

i trying call javascript function inside php code loop. not working. guess there wrong in line have called function. please suggest how edit code javascript function can work properly. code have tried. <?php ?> <script> function calculate(aa, mad, hs, gra, mas, nsm, phd, exp, intv){ document.getelementbyid(aa).value=document.getelementbyid(mad).value/10 -(- document.getelementbyid(hs).value/10)-(-document.getelementbyid(gra).value/5)-(-document.getelementbyid(mas).value/5)-(-document.getelementbyid(nsm).value)-(-document.getelementbyid(phd).value)-(-document.getelementbyid(exp).value)-(-document.getelementbyid(intv).value); } </script> <?php echo " <form action='gl1p.php' method='post'>"; $noc=20; echo " <table align='center' border='1' style='border-collapse:collapse' align='center'><tr> <th>sl. no</th><th>name</th><th>caste</

i have servlet, myservlet, in web.xml file under servlet-mapping have mapped url-pattern, index.html. requests http://mydomain/myservlet/index.html invoke servlet fine. requests http://mydomain/myservlet/ invoke pop-up login window. tried pattern /* instead, destroyed path stylesheets etc, , if put these in top level cause problems local hard-coded files. is there way use urlrewritefilter (or else) incoming request http://mydomain/myservlet or http://mydomain/myservlet/ remaps http://mydomain/myservlet/index.html nothing else touched? (i'm testing servlet on tomcat on local machine, although it's being deployed on old sun webserver.) i think should trick: <?xml version="1.0" encoding="utf-8"?> <!doctype urlrewrite public "-//tuckey.org//dtd urlrewrite 3.0//en" "http://tuckey.org/res/dtds/urlrewrite3.0.dtd"> <urlrewrite> <rule> <from>^/myservlet[/]{0,1}$</from>

i have thirteen spreadsheets in workbook, first spreadsheet master schedule contains table column headers: "location", "equipment", "make/model", "serial #" , "calibration due date". twelve other spreadsheets have tables these same column headers, each 1 corresponding different months. when enter data row in master schedule, want data automatically entered 1 of twelve other spreadsheets based on "calibration due date". example, if enter row of data in master schedule contains calibration due date of 01/16/15, want row of data inserted table in january spreadsheet. i wrote formula in each of monthly spreadsheets causes data entered master schedule automatically entered spreadsheet, set filter 'calibration due date" column january january spreadsheet , did same rest of months, however, when new data added master schedule, row of data entered every spreadsheet instead of single spreadsheet corresponding date, fil

i using bootstrap css navbar , cannot change color of text inside navbar. html code: <nav class="navbar navbar-default navbar-fixed-top" ng-controller="navctrl"> <ul class = "nav navbar-nav"> <li><a class = "nav_color"><span class="glyphicon glyphicon-user"></span> username </a></li> <li><a class = "nav_color"><span class="glyphicon glyphicon-book"></span> book </a></li> <li><a class = "nav_color"><span class="glyphicon glyphicon-pencil"></span> pencil </a></li> </ul> </nav> and here css code: .nav_color { color: red; } i don't understand why isn't working axc , hi there. try doing this. .nav.navbar-nav li { color: red; }

i'm trying run apriori arules package , running memory issues. far can read in data , split correct format doing basket analysis, when try convert data transaction type i'm getting error due size (about 800,000 rows). is there packages can me handle size of data? as((split(first2$product,f = first2$transaction_id)),"transactions") i've been stuck on week now, advice appreciated. it depends on how many items (columns) have , how sparse data (items per transaction). apriori implementation in arules requires transactions reside in main memory. if can read in data as(data, "transactions") fails, can try directly create sparse ngcmatrix package matrix , use create itemmatrix (which transactions is). see r> class? ngcmatrix r> class? itemmatrix r> class? transactions unfortunately painful.

i have following requirement, sample data: numberid startdate, enddate --------------------------------------------------- 1900415115 2012-09-22 00:39:00 2013-10-25 00:00:00 2429398311 2008-05-22 16:57:00 2013-07-30 00:00:00 4337719455 2008-05-22 16:57:00 2009-06-12 00:00:00 6644946399 2008-05-22 16:57:00 2009-01-16 00:00:00 9740698857 2008-05-22 16:57:00 2008-09-26 00:00:00 3928192597 2011-08-24 12:14:00 2012-09-24 00:00:00 1233655116 2013-08-14 00:39:00 2013-12-09 00:00:00 1780419233 2008-10-22 00:08:00 2014-08-24 00:00:00 1912939738 2011-08-26 01:32:00 2014-06-20 00:00:00 3810216146 2008-05-22 16:57:00 2009-01-16 00:00:00 5851814815 2009-10-07 01:00:00 2010-01-25 00:00:00 3692916726 2008-05-22 16:57:00 2008-10-02 00:00:00 3069490750 2008-05-22 16:57:00 2009-08-14 00:00:00 i want check if 'numberid' exists in date range , want group 01/01/2008 - 01/01/2009 0809 01/01/2009 - 01/01/2010 0910 01/01/2010 - 01/01/2011 1011 01/01/2011 - 01/0

i have simple form. when page loads, input fields empty, , placeholder appears when click on field. <input type="text" onblur="if(this.value=='') this.value='vorname, name';" onfocus="if(this.value=='vorname, name') this.value='';" name="dynamic_0" title="vorname, name" value=""> how can placeholder visible on page load well? use html placeholder element <input type="text" placeholder="whatever want" onblur="if(this.value=='') this.value='vorname, name';" onfocus="if(this.value=='vorname, name') this.value='';" name="dynamic_0" title="vorname, name" value=""> for old ie compatibility should check out polyfill aswell: https://github.com/ginader/html5-placeholder-polyfill

i'm stuck problem few days , think time help. i'm updating angular app v1.3.0-beta.17 v.1.3.x (head) , i'm getting message warning: tried load angular more once. . weird thing noticed jquery loading / route , scripts again afterwards through ajax. see: also problem occurs 1 route (described below). have ideas on why jquery behaving this? here's routes: javascript $routeprovider .when('/', { 'controller': 'loading', 'templateurl': versioning('/assets/template/system/blank.html') }) .when('/dashboard/:dashboard_id', { // route error 'controller': 'loading', 'templateurl': versioning('/assets/template/dashboard/dashboard.html') }) .when('/dashboard/:dashboard_id/widget', { 'controller': 'loading', 'templateurl': versioning('/assets/t

to communicate service, different between bindservice() , create instance of service? why should need use bindservice() communicate service? confused it. (1) public class bleservice extends service { private static bleservice sservice; @override public void oncreate() { super.oncreate(); sservice = this; } public static bleservice getinstance() { return sservice; } } public class heartrateactivity extends activity { private bleservice mbleservice; @override protected void oncreate(bundle savedinstancestate) { super.oncreate(savedinstancestate); mbleservice = bleservice.getinstance(); } } (2) public class bleservice extends service { private final ibinder mbinder = new localbinder(); private bleservice mbleservice; public class localbinder extends binder { public myleservice getserverinstance() { return myleservice.this; } } } public class heartrateactiv

say create mailbox using mailbox = signal.mailbox action , type action = blah , later can send actions mailbox using signal.send mailbox.address blah , allows me listen on mailbox.signal , how so? mean, after all, type mailbox alias of {address : signal.address action, signal : signal.signal action} , because that, in elm, there 1 signal type, in above scenario, don't have tell elm bind mailbox.signal mailbox.address , elm figure out because of one-to-one correspondence between address , signal of type? the ability mailbox put events send signal entirely based on "magic", is, it's implemented natively (in javascript) , not implement yourself. that's why it's built-in in standard libraries. creating mailbox imperative, effectful action (shhh, don't tell anyone). if use: mailbox1 = signal.mailbox blah mailbox2 = signal.mailbox blah those 2 mailboxes distinct. send message mailbox2.address result in message on mailbox2.signal not mail

i tried make search task of telephone directory, don't know problem. this's code: in adapter: public class listcontactadapter extends arrayadapter<contact> { private context context; private int layoutresourceid; private list<contact> contact; public listcontactadapter(context context, int layoutresourceid, list<contact> contact) { super(context, layoutresourceid, contact); this.context = context; this.layoutresourceid = layoutresourceid; this.contact = contact; } public view getview(final int position, view convertview, viewgroup parent) { textview tvphonenumber; textview tvname; view row = convertview; layoutinflater inflater = ((activity) context).getlayoutinflater(); row = inflater.inflate(layoutresourceid, parent, false); tvphonenumber= (textview) row.findviewbyid(r.id.textviewphoneno); tvname = (textview) row.findviewbyid(r.id.textview

[{ "sys_id": "2015-07-018", "account_id": "2015-07-018", "names": [{ "fname": "jackie", "mname": "lee", "lname": "chan", "suffix": "jr", "city": "tokyo", "town": "shinagawa-ku", "dstrct": "district 2", "street": "jr", "contactnum": "1234" }, { "fname": "jackie", "mname": "lee", "lname": "chan", "suffix": "jr", "city": "tokyo", "town": "shinagawa-ku", "dstrct": "district 2", "street": "jr", "contactnum": "1234" }, {

when open link mechanize: r = br.open(url) print(r.read()) the returned results like: [{"name":"name","year":"2000","link":"link"}] how can convert response dict can access later. thx in advance. load json module: import json data = json.load(r) note don't need call read() explicitly, load() you.

i trying bind jqxdropdownlist selected value ko.observable , can't figure out wrong. working regular <select> tags , not working <div> element, showing in html bellow. need replace <select> jqwidgets dropdownlist , bind accordingly stated in working code. viewmodel: var viewmodel = function(){ var self = this; self.patternselectedindex = ko.observable(0); self.windowselectedindex = ko.observable(0); self.colorselectedindex = ko.observable(0); self.hardwareselectedindex = ko.observable(0); self.selectedmake = ko.observable(); self.selectedtype = ko.observable(); self.makes = [ {id:1, name: 'northwoods prestige', dimensions:true}, {id:2, name: 'forest bay', dimensions:true}, {id:3, name: 'timberland', dimensions:true} ]; self.types = [ {id: 1, make:1, name:'special reserve 138', patterns:[{file:'fb_classic', name:'fb clasic&#

i've setup gitlab using omnibus package on centos 7. i'd use gitlab server host additional websites. i've enabled custom nginx conf adding below code /etc/gitlab/gitlab.rb nginx['custom_nginx_config'] = "include /etc/nginx/conf.d/*.conf;" i've created conf files in /etc/nginc/conf.d. static html files working when try run php scripts, i'm getting file not found - 404 error. following nginx conf php : server{ listen 80; server_name example.com; root /var/www/vhosts/example; index index.php index.html index.htm; location / { try_files $uri $uri/ =404; } error_page 404 /404.html; error_page 500 502 503 504 /50x.html; location = /50x.html { root /opt/gitlab/embedded/html; } location ~ \.php$ { fastcgi_pass 127.0.0.1:9000; fastcgi_index index.php; include /opt/gitlab/embedded/conf/fastcgi_params; fastcgi_param script_filename $document_root$fastcgi_s

i'm trying instantiate variable contents of gettext method using webdriverio. = string(browser.gettext('.field_notice')); when attempt print variable output: [object object] thanks help! browser.gettext() asynchronous call need provide callback instantiate variable. try : browser .gettext('.field_notice').then(function(text) { = text; }); a similar example can found on webdriverio developer guide : http://webdriver.io/guide.html also, there no need convert variable string since method returns string. see https://github.com/webdriverio/webdriverio/blob/master/lib/commands/gettext.js

i got part of c program: #include <stdio.h> #include <string.h> #include <stdlib.h> int main(void){ char *mrna = spleissen("auaguaaaagcucuguuuaggaga", "gu", "ag"); printf("mrna: %s\n", mrna); free(mrna); return 0; } i have write function spleissen should work this: cuts out string goes gu ag , in between two. program output is: mrna: auacucugaga i don't know how can cut parts out. i not allowed use includes other stdio , string , stdlib . char *spleissen(const char *src, const char *start, const char *end){ size_t len = strlen(src); char *s, *e, *ret, *work; ret = work = malloc(len + 1); strcpy(work, src); len = strlen(end); while(s = strstr(work, start)){ if((e = strstr(s, end))==null) break;//delete upto last? memmove(s, e + len, strlen(e+len)+1); work = s; } return ret; }

when user access token , getting error . please me immediately. how can solve this,tell me stdclass object ( [error] => stdclass object ( [message] => active access token must used query information current user. [type] => oauthexception [code] => 2500 ) ) require 'facebook-php-sdk-v4/src/facebook/autoload.php'; require("facebook.php"); $fb = new facebook\facebook([ 'app_id' => '1501716620042981', 'app_secret' => '510d15193610ca682b7f79c156992bb5', 'default_graph_version' => 'v2.3', ]); $helper = $fb->getredirectloginhelper(); try { $accesstoken = $helper->getaccesstoken(); } catch(facebook\exceptions\facebookresponseexception $e) { // when graph returns error echo 'graph returned error: ' . $e->getmessage(); exit; } catch(facebook\exceptions\facebooksdkexception $e) { // when validation fails or other local issues echo 'facebook sdk retur

i have 2 large datasets, df1 , df2. first dataset, df1, contains columns 'id' , 'actual.data'. df1 <- data.frame(id=c(1,1,1,2,3,4,4), actual.date=c('10/01/1997','2/01/1998','5/01/2002','7/01/1999','9/01/2005','5/01/2006','2/03/2003')); dcis <- grep('date$',names(df1)); df1[dcis] <- lapply(df1[dcis],as.date,'%m/%d/%y'); df1; id actual.date 1 1 1997-10-01 2 1 1998-02-01 3 1 2002-05-01 4 2 1999-07-01 5 3 2005-09-01 6 4 2006-05-01 7 4 2003-02-03 the second dataset, df2, contains 2 date fields, 'before,date' , 'after.date', represent start , end date, respectively: df2 <- data.frame(id=c(1,1,1,2,3,4,4,4), before.date=c('10/1/1996','1/1/1998','1/1/2000','1/1/2001','1/1/2001','1/1/2001','10/1/2004','10/3/2004'), after.date=c('12/1/1996','9/30/2003','12/31/2004',&#

i new eventbus() function in sapui5. using eventbus.publish() in table.view.js controller publish data & have used eventbus.subscribe() in mainpage.view.js controller. working fine. while try implement eventbus.subscribe() in controller ("feed.view.js"), not working. why so? the cause of problem 1 of following: you not using same eventbus in cases (e.g. in 1 case use sap.ui.getcore().geteventbus() , , in case use component's ocomponent.geteventbus() ) you not using same channel you not using same event id please check this, , if doesn't post more of code.

when post product, it's image shown in product listing page.but image not found error in product view page. tried following: checked permission of media folder , subdirectories(0777) renamed htaccess file in media folder checked gd library installed or not(installed) image, small_image & thumbnail attributes; changed these attributes have scope = global increased memory limit in htaccess file cleared cache reindexed image shown in listing page image not found in product description page.

i have sample of vba lookup concatenation of 2 columns. looksup database feed, row count between 35k , 250k. doing vlookups way slow times 60 500 seconds. efficient way the same result. sequence turns of screen updating turns off calculations disables database clears clipboard cache refreshes db data sets lookups turns on calculations turns off calculations copy , pastes values of vlookups. enables database turns on s sub startcom() dim ii long, lastrow long dim starttime double dim secondselapsed double ' starts timer starttime = timer 'freeze screens, clears cache , stops cals stopall 'set error traps , start , end times on error goto errortrap: set sht1 = wsrag set sht2 = wscomdata sht2.select reflist 'find last row (in column a) data. , set start row data copy lastrow = sht1.range("a:a").find("*", searchdirection:=xlprevious).row ii = 9 'disables db connection wsconfig.cells(7,

i need use jquery animations, please not mention transitions. this code base var commentform = react.createclass({ componentwillunmount: function(cb) { console.log('hiding') jquery(this.getdomnode()).slideup('slow', cb); console.log((this.getdomnode())) }, componentdidmount: function() { jquery(this.getdomnode()).hide().slidedown('slow'); if (this.props.autofocus) { jquery(this.refs.commentarea.getdomnode()).focus(); } }, render: function() { return ( <div> <div classname="panel-footer" ref="commentcomponent"> <form role="form"> <div classname="form-group"> <textarea classname="form-control" placeholder="say nice!" ref="commentarea"></textarea>

i trying make expandable accordion menu css , jquery, want make vertical accordion menu , hide sub-menus when click on other main links, can 1 please me this. jsfiddle link $(function() { $('.submenu-class li').has('.mainmenu-submenu, .mainmenu-submenu-sub, .mainmenu-submenu-sub-sub').prepend('<em class="mainmenu-click"><i class="arrowupdown"></i></em>'); $('.submenu-class li').has('.megamenu').prepend('<em class="mainmenu-click"><i class="arrowupdown"></i></em>'); $('.mainmenu-mobile').click(function(){ $('.submenu-class').slidetoggle('slow'); }); $('.mainmenu-click').click(function(){ $(this).siblings('.mainmenu-submenu').slidetoggle('slow'); $(this).children('.mainmenu-arrow').toggleclass('mainmenu-rotate'); $(this).siblings('.mainmenu-subme

i'm trying create function generate dropshadow-like gradient on given edge of control. i'm not extremely familiar system.drawing , have used once before, , used experience try make this. drawing gradient, one-pixel line one-pixel line (through loop uses value called length determine number of lines), changes based on alpha value of pen i'm using. the issue either i'm incorrectly calculating how alpha value next line, or i'm using system.drawing incorrectly. think may latter; can't figure out how bitmap i'm generating display, whether using graphics graphics = this.creategraphics() or setting graphics bitmap . i'm not sure how break code question, it's relatively short function anyhow. see documentation more details on how function supposed work. /// <summary> /// generates simple drop shadow @ rectangular angle along edge of control of choice. /// </summary> /// <param name="startalpha">the starting alpha

i building app app inventor . use webviewer load javascript code (see below) displays, in table, content of database stored in tinydb . so have table looks that: i've tried make content of table editable adding @ bottom of script without success: table disappears. <script> function myfunction() { document.getelementbyid("mytable").contenteditable = true; } </script> also i've seen page . can't find way implement .js in app inventor app. any idea how make work? <body> <div id="mytable"></div> <script> // table display window.appinventor object , split @ new line var urlarray = window.appinventor.getwebviewstring().split("\n"); var doc = document; var fragment = doc.createdocumentfragment(); for(i=0;i<urlarray.length;i++){ var tr = doc.createelement("tr"); // split @ comma var rowarray = urlarray[i].split("|"); fo

i've got problem when trying compress .xls file zip file in bpm platform (bea aqualogic bpm - studio). code far: try { fileoutputstream fos = fileoutputstream(arg1 : "/home/and/reportes/ziptest.zip"); zipoutputstream zos = zipoutputstream(arg1 : fos); logmessage("mas - zippeo en: " + url); java.io.file file = java.file(arg1 : url); fileinputstream fis = fileinputstream(arg1 : file); zipentry entry = zipentry(arg1 : url); zos.putnextentry(arg1 : entry); int buff = 1024; byte[] buffer = new byte[buff]; int length; //int buffer = 1024; while((length = fis.read(buffer,0,1024)) >= 0){ zos.write(arg1 : buffer, arg2 : 0, arg3 : length); } } catch (filenotfoundexception e) { logmessage("mas - fnfe: " + e.stacktrace); } catch (ioexception e) { logmessage("mas - ioe: " + e.stacktrace); } what i'm getting, compiling error: ''byte'' not expected and simple quotation marks btw (as in ' ') any idea or

i'm trying delete specific row parse table, i'm getting object parse table , adding arraylist, when i'm clicking on list view i'm first checking if value 1 clicked on right one,thats ok , when i'm trying delete specific row it's deleting last row i'm doing wrong? here code parsequery<parseobject> query = parsequery.getquery("smstable"); (int = 0; <cm.mlist.size() ; i++) { query.whereequalto("objectid", cm.mlist.get(i)); } query.findinbackground(new findcallback<parseobject>() { public void done(list<parseobject> objects, parseexception e) { if (e == null) { // iterate on messages , delete them (parseobject smsobject : objects) { smsobject.deleteinbackground(); } } else { //handle condition here } } }); a query supports 1 constraint of type per field. you're doing in loop overwrites whatever have s

i getting nullpointerexception @ sharedpreferences. here code: public void onclick(view v) { phone = (edittext) findviewbyid(r.id.phoneno); final string number = phone.gettext().tostring(); new alertdialog.builder(mainactivity.this) .setmessage("confirm number:+91-" + number) .setpositivebutton(android.r.string.yes, new dialoginterface.onclicklistener() { public void onclick(dialoginterface dialog, int which) { sharedpreferences.editor editor = sharedpreferences.edit(); editor.putstring(phone, number); editor.commit(); intent intent = new intent(mainactivity.this, navigationfarmer.class); startactivity(intent); finish(); } }) .setnegativebutto

i have query calling columns way want, cannot use columnlist of query because sorts column alphabatically, thing need specific row of query , associated columns in structure: so here function trying bring columns in manner want: <cffunction name="rowtostruct" access="public" returntype="struct" output="false"> <cfargument name="queryobj" type="query" required="true" /> <cfargument name="row" type="numeric" required="true" /> <cfset var returnstruct = structnew()> <cfset var colname = ""> <cfset arguments.queryobj = arraytolist(arguments.queryobj.getmeta().getcolumnlabels())> <cfloop list="#arguments.queryobj#" index="colname"> <cfset "returnstruct.#colname#" = arguments.queryobj[colname][arguments.row]> </cfloop> <cfreturn returnstruct/>

i don't know exact cause of guessing has container view controller being used. using several containers, 1 swrevealviewcontroller , houses generic uiviewcontroller rearviewcontroller , uinavigationcontroller frontviewcontroller. root view controller of navigation controller container view controller, mainviewcontroller, contains uipageviewcontroller . page view controller has 3 uitableviewcontroller s , when try navigate table view controllers relevant view controllers (via segue), , want push transition, makes modal transition gives? it hierarchy guess, kinda messed these view controllers right , think broke brain @ point. appreciate if knows wrong can explain. was stuck same problem , tried solve 2 days, , solved that.. view hierarchy: container view first controller (direct child of container) second controller (direct child of container) third controller fourth controller solution added navigation controller first controller added navigation